In This Section |
Genomics - A Fast Train Coming
It would be almost impossible for beef producers at this stage to not have had some exposure, either in articles or advertising to the use of DNA technologies in beef cattle. Genomics is the buzz word and simply refers to the general field of genetics using DNA technologies. At this stage, the implementation of DNA markers is still pretty sparse, with most producers not yet using the technology although the tools are readily available, with three major companies competing in North America. What producers on the front lines today don't realize is that the tools that will be available in the future for selection and management will be greatly different then those of today. This article is intended as an introduction to the subject and to give the beef industry an idea of the impact to expect from the genomics train that is racing down the industry track. Genetics 101The DNA that is in every cell of the beef animal contains the code that will determine the genetic basis of everything that animal will become, from its hair color to its capacity for growth rate, to the tenderness of its meat. Obviously, the environment (feeding program etc.) has a huge impact on the animal's development as well. In fact, for most of the traits we are interested in, the environment will be responsible for 60-80 per cent of the differences that we see among animals. The 20-40 per cent of the differences that are due to genetics are very valuable, and we can exploit these for effective genetic selection as can be seen in genetic trends for traits like growth in beef cattle, milk in dairy cattle and lean growth in swine. What genomics allows us to do is to directly read the animal's DNA and determine what that animal's potential is for a trait, for example lean meat yield. This is the destination, but getting there is a long haul. The good news is, the technology is advancing at an incredible rate. Much of the improvements to technology have been related to the Bovine Sequencing Project, which has sequenced the genome of the bovine. The DNA code for an animal is made up of four basic elements (called primary nucleotides) and we will represent these by their first letters, G, A, C and T. The animal's sequence is then just a unique sequence of these four letters, like AAGCTCGTGGCAATGGTCCATAGCCC However, the code for a single animal includes three billion letters. If you were to type out this code for an animal on a typewriter in standard 10cpi font, you would have a ribbon of Gs, Cs, As and Ts that would stretch across Canada from coast to coast. If you were to sequence two different cows and line their ribbons of code up, you would find that for much of the time, the codes are the same. The reason for this is that any two cows, even if they are different breeds, have much more of their codes in common than that which differs. For example, both are cows, have four legs, two eyes, hair, are mammals etc. For this reason, a lot of the code is the same. However, as you travel along from Halifax to Victoria reading these two ribbons for these 2 cows, you will notice where there are some differences between them, for example where a G might be in one cow, at the same location on the other cow might contain a C. This difference is called a Single Nucleotide Polymorphism or SNP (pronounced "snip"). There are over two million of these SNPs identified in cattle to date (more will be discovered). That means that as you traveled across the country reading this code, you would run into a SNP about every 1500 letters or every 12 feet. If you can imagine stopping every 12 feet from Halifax to Victoria, you can soon imagine that there are a lot of SNPs discovered! These SNPs are the fundamental genetic differences that we want to exploit when we select animals. This may sound like science fiction, but it is not. In fact, beef breeders have been doing this since cattle were domesticated. Consider our cross-Canada ribbon of As, Gs, Cs and Ts. Let's say a particular beef breed is selecting for more growth rate and there is a SNP on the Ribbon just east of Bowmanville that is a G/C, where animals that have a G at this spot grow faster then those that have a C. Over time, as selection pressures continue for growth rate, the occurrence of Gs will increase as bulls with GG genotype (the "ribbons" are actually paired in an animal, since each cell has a pair of each DNA strand) will tend to be faster growing then CC bulls, and as more and more GG bulls are used the occurrence of a G at this location becomes more common until eventually the Cs at this location disappear altogether. This breed is then fixed for Gs at this location. You might think that after selection for some time, that a breed would fix all the good SNPs and response to selection would stop. This has been shown to not be true, as along the genome there are mutations happening as well. These mutations create new SNPs and some of these will be related to growth rate as well, so selection can continue. In fact, as has been shown with experimental fruit flies (that reproduce very fast), after hundreds of generations of selection, selection response does not diminish. This is good news for livestock breeders. "The Gene" Does Not ExistWhen genetic testing was first released as a commercial service, breeders used to say "They found the marbling gene, now we don't have to use ultrasound anymore." This statement is wrong on two accounts. Firstly, "The Marbling Gene" does not exist. There are many genes that influence an animal's genetic potential for marbling. In fact, for most of our traits it is estimated that close to 100 SNPs will be required to explain almost all of the genetic differences for each individual trait. Secondly, genomics is developing into an incredible tool that will revolutionize the genetic improvement industry, however, we are a long way from abandoning traditional recording programs in beef cattle in the near future. Genomic technologies will instead be a tool integrated into those systems. EPDs in the future will combine the DNA, pedigree and animal performance data together to provide a more accurate and informative estimate of the animal's genetic potential for a trait, so the rate of genetic improvement can increase. Turning SNPs Into ImprovementAs mentioned, there are many SNPs identified in cattle. This in itself gives the beef breeder nothing to use. What is needed is a relationship between these SNPs and the traits that are of interest. This is exactly where research at the University of Guelph is positioned. The University of Guelph, through a collaboration with the Alberta Bovine Genomics Program at the University of Alberta is genotyping 1250 cattle for 50,000 (50K) SNPs each. The cattle are measured for a number of important traits from birth through to carcass, including traits like feed efficiency and beef tenderness. The research will determine which SNPs are related to a trait, for example, feed efficiency. These SNPs can then be moved to a commercial DNA testing panel for beef breeders in the field to use to improve selection for these traits. This research is leading edge. This Canadian initiative is collaborating with the United States Department of Agriculture and the Beef CRC in Australia to combine datasets to provide the best tools to breeders in all three countries, as it has been determined that there will be more power in a combined data set. Inclusion in these international activities indicates the tremendous resource that we have available in Ontario. Arriving or Leaving the Station?We have had much discussion of current research and what is coming down the track. However, there are genomics tools available now which have been validated to be quite useful to breeders. Also, these commercially available tests are constantly increasing in power as more and more SNPs are discovered to be associated with key traits. Current research at the University of Guelph is involved with validating new panels of SNPs due to our unique data resource. Producers can expect some improved panels in the near future, ahead of results from the 50K genotyping project mentioned above. Speculation is always dangerous. However, looking to the future, a producer might ask what to expect next? When will bigger panels of SNPs be available and how big will they be? Based on how technologies are unfolding, it would appear that while we have had panels of SNPs commercially available for the last few years with two SNPs, this could jump to 10-20 SNPs over the next two years, and by 2012 we will see these commercial panels double again in size to 40 SNPs. This is exciting technology acceleration! Future ArticlesNow that the basics of genomics, genetics and the current state of technologies is established, future articles in OMAFRA Virtual Beef can focus on the practical development and validation on new DNA tools to select for important traits like beef tenderness and feed efficiency. AcknowledgementsGenomics research at the University of Guelph would not be possible without
the funding from our partner, the Ontario Ministry of Agriculture, Food
and Rural Affairs, which supports research stations (along with their
cattle and staff) and research projects. Funding from the Ontario Cattlemen's
Association and the Agriculture Adaptation Council is also gratefully
acknowledged. Toll Free: 1-877-424-1300 Local: (519) 826-4047 E-mail: ag.info.omafra@ontario.ca |
This site is maintained
by the Government of Ontario
Queen's Printer
for Ontario
Last Modified: